Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone GC0100
Clone ID GC0100
Cell line E14Tg2A.4
Vector pFLIP1
Project tigem
Note NULL

Sequence tag GC0100
Sequence
GCTCTCCACTTCGCTGCCTTTNTTGGCGATCGAGTGTTCCCCATGACCCG
Sequence Type mRNA
Unitrap ID UNI139

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 146475603..146475653 45
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005034 (Prkacb) NM_011100 protein kinase, cAMP dependent, catalytic, beta Gene [Source:MGI (curated);Acc:Prkacb-001]

 
Come back to gene ENSMUSG00000005034


For any suggestions or comments, please send an email to unitrap@crg.es