Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15070B7
Clone ID IST15070B7
Vector VICTR80
Project tigm

Sequence tag IST15070B7HMR1
Sequence
CATGGGTGTTCGCCATGCATGGTAGCAAATAAACTGCTGCCGTCCAGCTGCAAGGTCTCAACTTGTTTTTGGATGCAACC
TAC
Sequence Type genomic DNA
Unitrap ID UNI10489

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 110019031..110019113 83
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032480 (Dhx30) NM_133347 DEAH (Asp-Glu-Ala-His) box polypeptide 30 Gene [Source:MGI Symbol;Acc:MGI:1920081]


Sequence tag IST15070B7HMF1
Sequence
CATGAACTGGGGGTTGTAAGGTGAACAGTCTCTGCATTGGAAAGCCGCAATTAAAAGACCAATATTGCTTACACAAGGAC
TATCTAGAAAGCACATAGACGCTGTACTCTTGGCTTGAGGATTCTGAAGACCCCTGGGAACTCCACTTCACTGCAAACAA
AGGACCCACCATGCATTAGGTCTTCCCCTGCAAAATGGGACAAGTCACTACCAGCAAACAAAGAACACCTCACCCCTTAG
CCTCCCCCACTGACAAGGTCGGTGCAANNNNNNGCAAACCANAAGAGTCAAAAATGCACCAAGGCCTCCCTTTANAGGAA
CGGTCCTGACCCGCACAGTGGGAGGAGGGGCAGACAAAGGTCTCGGGCACTCCGGANACTTCCTCCGGNCCCAGCCTGGG
GAAAACCGAGCATCCCCTGANGCNAANGCGTCGTCGANCCNATGAAGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 110019110..110019557 418
 
EST/CDNA Est Name
  CJ137405.1 - CN682925.1 - BY753988.1 - BY738211.1 - CF170187.1 - CF170183.1 - BY739071.1 - CF728047.1 - CN694629.1 - CA979978.1 - CD544299.1 - CD540910.1 - CN669541.1 - BB851705.1 - BY274609.1 - CJ151389.1 - AI789271.1 - BY249109.1 - BB846569.1 - BY280970

 
Come back to gene CJ137405.1 - CN682925.1 - BY753988.1 - BY738211.1 - CF170187.1 - CF170183.1 - BY739071.1 - CF728047.1 - CN694629.1 - CA979978.1 - CD544299.1 - CD540910.1 - CN669541.1 - BB851705.1 - BY274609.1 - CJ151389.1 - AI789271.1 - BY249109.1 - BB846569.1 - BY280970


For any suggestions or comments, please send an email to unitrap@crg.es