Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14198A1
Clone ID IST14198A1
Vector VICTR74
Project tigm

Sequence tag IST14198A1HMR1
Sequence
TTTGTCTGCATACATACATACGAACAAACAGGCAAAACTCTGATTCNCATAAAAATATTCTTGAGAATGAACTTAGAGCT
GTGGCTAACATGAGTATTTGGTGTGTACCAGATGCTGGGGGTGCATGCTGTTTAGCATTATTTTGTTTAATCCTCTCAGC
AATATTGTATGTTAGAAATTATTCCATTTTATAGATAAGGAAGCTAAAGTAAGATGTTTCCNAATCTGTATTATCTTATT
TGTAATGTATATAAATGCCATGAAAACTAGGTCATGATCTATAGCTGCCTCANTCTAAAATAGTCTAAGACTAACTCAGT
CTAAGTCTGANATGCTCGTGTGTGTGTCANTTGGTTGGAANGCTCAATAAAATACACATTGCTGTNCTTGATTCCCCAGA
GTTTGTCTTTACCTANGTCTGAAGTGANGCTCAAGANTTTGCATGGTCTCCTAAGTTTCCNNGTAACGTTGATGCTTN
Sequence Type genomic DNA
Unitrap ID UNI17749

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 102843250..102843725 452
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000068823 (Csde1) NM_144901 cold shock domain containing E1, RNA binding Gene [Source:MGI Symbol;Acc:MGI:92356]


Sequence tag IST14198A1BBF1
Sequence
CAACATTTGGTGACTGGTGCCCACAAAGGCCAGAANAGGCCATCAGATGCCTTGCAACTGAGTATGTATGCGCTGAGGTT
GGTGCTAGGAACTGAACGTAGGTCCTATACAAGAGTATCAAGTATTCAAACTACTGTGGCATCTTTCTAGCCTCTTGGGA
TTTTTTTTTGTTGTTTTANTTTAANAAATCTTATAATTTCNTTCCNTNAANTCNTCNAANTNTCTAAAGAAAAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000068823


For any suggestions or comments, please send an email to unitrap@crg.es