Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D021A06
Clone ID D021A06
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D021A06
Sequence
TTGTTCTCGATACTTCGTTGTGGTTGTGAACTCTGTCCGGCAGCCTCGGGCCTGCGGTCTTGAGACGGAGCACCATGCCT
ACGATAAAGTTGCAGAGTTCTGATGGAGAGATATTTGAAGTTGATGTAGAAATTGCCAAACAATCTGTGACTATCAAGAC
CATGCTGGAAG
Sequence Type mRNA
Unitrap ID UNI10878

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 52045547..52050435 97
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036309 (Skp1a) NM_011543 S-phase kinase-associated protein 1A Gene [Source:MGI (curated);Acc:Skp1a-002]


SPLK-Sequence tag 3SD021A06
Sequence
ACTGCTNNCTGTTTTGTTGTAGAAAAGAAGCTGTATGGATCAGATGCTCTTGAAGACTTTCAAAAGTCTACACCTGAAGA
CTATCTGTATTTAA
Sequence Type genomic DNA
Unitrap ID UNI30311

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 52051731..52051824 90
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036309 (Skp1a) NM_011543 S-phase kinase-associated protein 1A Gene [Source:MGI (curated);Acc:Skp1a-002]

 
Come back to gene ENSMUSG00000036309


For any suggestions or comments, please send an email to unitrap@crg.es