Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P099E07
Clone ID P099E07
Vector rFlpROSAbetageo
Project ggtc

Sequence tag P099E07
Sequence
ACCCACATNNNAAACACGAACCTCCAGACCTGACCCCGCCTNNANNTATAAACTCGCCTCACAACNNCCATCCATCTCAC
CCCTAGCCTGACCAAACCCCTCATAACCACCACACCATAACAAAAANNACCAAGTCACCCCAAAATTCAACACCTNNCGA
AATCTACACGGCNNNNTNNNCCACCCNNAACGGATTTCAGCCCGAAAACNNCACCACACGGCCCTCCTTGTTAGAAGAAG
ACGAAGATGGCAAGGAAGACTCTGGAGGTAGTAGCATTNNAGAAGATGAAGAGGAGCAAGAAGGAGGCCTTGGGTCAGAG
AATGCAAGGAAGAAGAAGGAAGATGAGTTGTGGGCCAGCTTCCTTAATGATGTAGGACCAAAGTCAAAAGCAGCCCCAGG
TTCACAAACTAAGGTAGCCGAGGAGACTGAAGAGATTAGTTCGAATAACCCGTTGGTCAAAGCAGATGAGCTGGATAAGC
CTAGAGAATCAGAAAAGGTGAAGATTACCAAGGTGTTTGACTTCGCTGGCGAAGAAGTAAGGGTGCCTAAGGAAGTAGAT
GCTGCGTCTAAGGAAGCGAAGTCTTTCCTCAAGCAAACAGAGAGAGAAAANNNGCAGGCTCTTGTCACTTCACCAGCGAC
ACCACNNNCTGCTGGGTCAGG
Sequence Type mRNA
Unitrap ID UNI8740

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114354770..114365869 182
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031954 (Cfdp1) NM_011801 craniofacial development protein 1 Gene [Source:MGI Symbol;Acc:MGI:1344403]


SPLK-Sequence tag 5SP099E07
Sequence
AGTCTAGCAAAGATTTGGGGAAATGTCTGCAAAGTGTATTTGAGTTAGGTCATATGTGTTTCATGCAGTGCCATGCGGTT
AGTGTGCCTCCTGTTCCTAATAAGGGGCAGGCTGGCCTGTTTTAAATGAGGTGTCTGTGTTATGGAGCTGAAGGGATTGT
TTGCGCCCTGAGGGAGACCACCTCGTGTCCTGACATTTAAACATGACCTCAGCCTTAGAGATGCCTATGAATTTTAAATT
TATCTTATGTTGACATCTAGGTTTTTCATGTTTTTTTCTGAGGATACTACAGTTTAGGCTGCCTCAAGCTGGCTGCCTTT
ATAGATGGGTAAAGCTGCTCCTCGCTCACCTCAGCATCCTAAGCCCTGAACTGTGGGCGCACACCACTAAGCCTCTCTTT
TAAAATATTGGCCAGGGGTTGGTTGTTCAGTGTTCTGTGTGCTTTGAGACAGGTCTCATGT
Sequence Type genomic DNA
Unitrap ID UNI9019

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114312255..114312715 451
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031954 (Cfdp1) NM_011801 craniofacial development protein 1 Gene [Source:MGI Symbol;Acc:MGI:1344403]


SPLK-Sequence tag 3SP099E07
Sequence
CTCGGGGTTAGTTTGTTGTAAGGAGACAGAGTTGGGGGAGGAAGGGATGCTGAAAGTTGTGGAAAAAGCAGNNCACCGGA
GCTTAGGAAGTATGCCGAGTCCTCAGTAAGCAGACAGGCAAACAACCCACCATTGAGACACATAGGTCTTCTGTTGTACC
TCTCACCCTGGCTAGTTTAGAGAGGTGGGTTCAGCCATGTGGTCCTAACAGGAATAATGATTGTGTGAGTCTATAGCTCT
GTCCCTCAGACCAGCACATGCCTGACCTTCATGGGCTTGACAGGGTCACAGCAGAAAGCTAGGCACTGTTCTCCTTGAGA
GATCATTGCCTTTTAAACGCCAGAGGCTGGGCTGCCTGGGCTCCTTAGCTTTGTTGCTCGGATCGGCTGGCAGCCCATAT
GGNNNNCNTATCTGAAAAAGGGCNNNTGCTCCCTCCACTGAGCTCCCANNNNTGGGCAAAAAGAAANAGTCNATCTGGCC
CTTTCTTAAANANNGCCTTTAAATAATTGGTTAAAAATTCCACCTCA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000031954


For any suggestions or comments, please send an email to unitrap@crg.es