Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14054C4
Clone ID IST14054C4
Vector VICTR74
Project tigm

Sequence tag IST14054C4HMF1
Sequence
GCTGGAGGGGAGGCACAAAGAGCCACAGAAACAGGATTCCACGTACAAGAGCTTGTGAACACGGATTTCAGCCAGGCTGC
TCTCAAAGGCCCCTGGTCAGGAGCAGCANAGTGAGGATCTTTGGANAAAGAGATTCANAAACCCAGGTGTGATGGTGCAT
GCCTTGCATCCTTTGGAGGTACTTGGTACCTCCCGCACTTGGAGATAGAGGCAGGAGGNTGAGGAGTTCACAGCTAGCCT
GAGTTACATCTACCTGTCTGANAAATCATGGGGGGGGGGGGNNNAAAAAAAA
Sequence Type genomic DNA
Unitrap ID UNI31083

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 51851783..51852073 275
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000062785 (Kcnc3) NM_008422 potassium voltage gated channel, Shaw-related subfamily, member 3 Gene [Source:MGI (curated);Acc:Kcnc3-001]

 
Come back to gene ENSMUSG00000062785


For any suggestions or comments, please send an email to unitrap@crg.es