Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14778D6
Clone ID IST14778D6
Vector VICTR76
Project tigm

Sequence tag IST14778D6BBF1
Sequence
GGGGGATCANCAGTTCGAGGCTAACCTGAGCTTACGTGAGATACCTACTGTAAAACTTTAATTAAAAAAAAAAAAANANN
TTT
Sequence Type genomic DNA
Unitrap ID UNI30528

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 79459274..79459349 74
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017639 (Rab11fip4) NM_175543 RAB11 family interacting protein 4 (class II) Gene [Source:MGI (curated);Acc:Rab11fip4-001]


Sequence tag IST14778D6HMR1
Sequence
NCTCCNNGCNTNNNNNNTATCNTGCCGGGGAATCAAACTGGGGGGTTCATGAATGCTAAGTGAGCTCTCTGCCAACTGAG
TTACATCCCGGCTGCTCACCTGTGAGATGATGCTCTCTGTGTGCTGGAGACTAGCATAAGCACTGACTTAACAACCTGCC
TAACAGCACAGGAGGGAGCCGGTCTCACCCTCATCCCGCAGGTGANAAAACAGAAGTCACAGAACAGGAGGCAGCAGACA
AAGATATGGACTGTGAACCANGTGGTCTAACTGTGACCATTGCTGCCTGCTCCCCCANGACTGTCGGTGCTTCTGANACC
GAAAGCCGAAAGAAAGCCGACTGACTGGTCAGGGCTGGGAGCCCTGGGANGTGAACTGGCACAGGAGAAAAAGTGTCCAC
AGCTCTGCANCANTGTCTANATCTGTGGTTGGTCCNNANAACTTGTTANGATTCTGANTCTNNNNNNNACNNNNGACTGG
GGAGAGGANGGAGTGAATGTNNCCTGNCNTCTGCACTNNNCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14778D6HMF1
Sequence
GGGGATCANCAGTTCGAGGCTAACCTGAGCTTACGTGAGATACCTACTGTAAAACTTTAATTAAAAAAAAAAAAAAAANT
TNTTTTTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000017639


For any suggestions or comments, please send an email to unitrap@crg.es