Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14411A5
Clone ID IST14411A5
Vector VICTR74
Project tigm

Sequence tag IST14411A5HMR1
Sequence
NCCCTAATACCGTTCCGTTTTATTAGCTTTAATCCTAATGTTAAACATTANATTCCTATATATCCCATTTATTTTAACCT
CTTTTCCTGGGTCTCCCTCACCCACAGATTGATCCTCACCGTATGCAAACTTCATTCTTCCTTAAGCATTCCACATCCAG
GGGAAGCCAGGCANTGTTTTTATGTGTACACCTTATTTTAGTTAGCACANCATCTCTAGGTCCATTCATGTTGTTAAGGC
Sequence Type genomic DNA
Unitrap ID UNI7990

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 31670536..31670773 232
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022770 (Dlg1) NM_007862 discs, large homolog 1 (Drosophila) Gene [Source:MGI (curated);Acc:Dlg1-002]


Sequence tag IST14411A5BBF1
Sequence
GGATCTTTGTCAAATTAGCAGATTTTAGCTGCTTTTGACAAAAAATAAAAGTATGCAAGATACATTAACTGCCTCACTAT
AGTTCTATTTTACTATTTATCCATGAATCTCATAACATCATTTTGTAAACCTCAAATATACATGTTAAAATCTAACATCA
ATAAGGTTCACTACAGCCTCACCGGTGACATGGTTACTCTGGCCCTGATCTGTGTAGCTCCTAACCTTGGCCAGAGGTTT
CTTTTTNNNNTGGGCAGTAGTTAATGCAGAGGTTCATATCTGACCCAAGTGCTCAGGATAAGTGTGAATGCTCAGACCCA
AACAGGACATCACTGTCACCTTCCCACCNNGGCTCAAGGANCACTGTNNAANATGGGGTANAAAGGAGGAGGGTGGNCNC
NCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 31670142..31670537 374
NO GENE  

 
Come back to gene ENSMUSG00000022770


For any suggestions or comments, please send an email to unitrap@crg.es