Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CJ0555
Clone ID CJ0555
Vector pGT0lxrT2
Project sanger

Sequence tag CJ0555
Sequence
AGCTCCCACCCCCATGGAGGTGGCATCCAGCTACAGAACCGACTCCTTGCACTGTCTTTGGTGGGGGAGTTTCTCACCGT
CTTTGTACCCCACCTTCTCCAGTGAAAACCAACAGTTCGTGGGTTCCACCCCATTCCTGGTGGCCAGTCTTGCCCTGAAA
CCAGCTACCCCACCACAGCCACCGTCCCCAGCTTCTTCTCCAAGAGCAGCGACTTTCCTCAG
Sequence Type mRNA
Unitrap ID UNI1353

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 79545360..79549036 108
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035673 (Sbno2) NM_183426 strawberry notch homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2448490]

 
Come back to gene ENSMUSG00000035673


For any suggestions or comments, please send an email to unitrap@crg.es