Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13443E4
Clone ID IST13443E4
Vector VICTR74
Project tigm

Sequence tag IST13443E4HMF1
Sequence
CCCCTCCCTCTCCCACTCAAGGGCAAGACTCCATTAAAAAAACATAGGAGCTACTGCCTGCCTCTCCCTTAATTTCCCTC
CCTCCATTCAACCANAGAGAGGCATCTCTCCTCCCCCTTCTCCAAGCCGGAAAAGCAAAACACCTTCCAAACTCACAGCC
AAAGCCCCACCTAACTCCATTGTTCCTTACCCCATCATCTGTCACCCAACAGCTTTTTAATATTGGAGACTCTTGCAAAA
ACTAACCCCACCTCCCATTCTACTCAGGAGCCTGATACAGAACTAAAAACCCAAACCGCTCAAGCATTCCCAGTTC
Sequence Type genomic DNA
Unitrap ID UNI5870

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 101494288..101494602 313
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069089 (Cdk7) NM_009874 cyclin-dependent kinase 7 (homolog of Xenopus MO15 cdk-activating kinase) Gene [Source:MGI Symbol;Acc:MGI:102956]


Sequence tag IST13443E4HMR1
Sequence
AGGGGTAGGAGGAGCGAATAATTTATTTAGTTTTTCATCCTAGACATAAGGAGGCAGAGGTTGGTAGATGGATTTTATTT
CTCTTATTAATTGGGTAAGGGCTGTGAGATCTGAAATAGAGTGGTTTTTAGGACCTTGATCTTTGGGTTCAACTGACCAA
GGGGGCTAAGGACTGTGTTGCTATCACTCTGTCTTATTTTAGATGGCCCTATGCATTGCTGAATGGCAGCTAAGTTTGGC
AAAAAAAAAAAAAAAAAAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 101494598..101494858 261
 
EST/CDNA Est Name
  BY094824.1 - CF154923.1 - AA387188.1 - AA387466.1 - CB589397.1 - BY044812.1 - BY019626.1 - BY039479.1 - BY017404.1 - BY011178.1 - BE192866.1 - BY329464.1 - BQ570413.1 - CX216284.1 - CB231502.1 - BY774976.1 - BY306442.1 - BY794673.1 - BY792587.1 - CF158462

 
Come back to gene BY094824.1 - CF154923.1 - AA387188.1 - AA387466.1 - CB589397.1 - BY044812.1 - BY019626.1 - BY039479.1 - BY017404.1 - BY011178.1 - BE192866.1 - BY329464.1 - BQ570413.1 - CX216284.1 - CB231502.1 - BY774976.1 - BY306442.1 - BY794673.1 - BY792587.1 - CF158462


For any suggestions or comments, please send an email to unitrap@crg.es