Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13885G11
Clone ID IST13885G11
Vector VICTR74
Project tigm

Sequence tag IST13885G11BBF1
Sequence
ATCACCATGCTTGCTGTTTCANCCACCAGGGACCCTCATGGTGCTTGGCTCANAATATGAGACTTGGTACAGACGCTGGT
GAATATGCTCATTANACACCAGCCTANACTTCTCTCATATTCTCCTAGACTACAGACTGCTCTCTTTTTTGTACAATGAT
CTTCTGTGTTTCTTTCCCTCCCTCCCATCATCATCATCATTTTATTTTTTTAACTATGTAGCTCAGGTTGGCCTTGAACT
CTTTTTTAAAGATATTTTATTTATTTTATGTATATGAGTACACACTGTAGCTGTTCAGTTGGTTGTGAGCCTTCATGTGG
TTGTTGGGATCTGAATTTAGGACCTCTGCTCGCTCCAGTCAATCCTGCTCGCTCAGGTCCGCCCCACTCAATCAGTCCCT
GTTCGCTCCAGCTCAAANATTTATTCTTTACATAAATAAGANCACTGTANCTATGGCGTCAGATCN
Sequence Type genomic DNA
Unitrap ID UNI29695

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 34935561..34936025 447
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029106 (Add1) NM_013457 adducin 1 (alpha) Gene [Source:MGI (curated);Acc:Add1-002]


Sequence tag IST13885G11HMF1
Sequence
CTTCTAGTGTGTCTGAAGATAGCTACAGTGTACTAATGTATAATAATAAATAAATCTTTTCAAAAAAATTAAAAAGAAAA
GG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 32027079..32027159 79
NO GENE  

 
Come back to gene ENSMUSG00000029106


For any suggestions or comments, please send an email to unitrap@crg.es