Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14653D6
Clone ID IST14653D6
Vector VICTR74
Project tigm

Sequence tag IST14653D6HMR1
Sequence
ATGTAAGCACACTGTAGCTGTCTTCAAACACTCCAGAAGAGGGTGTCAGGGCCGGGCGTGGTGGCACACGCCTTTAATCC
CAGCACTTGGGAGGCAGAGGCAGGTGGATTTCTGAGTTTGAGGCCAGCCTGGTCTACAGAGTGAGTTCCNGGACAGCCNG
GGCCACACANANAAACCN
Sequence Type genomic DNA
Unitrap ID UNI31092

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 117545466..117545642 169
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025571 (Tnrc6c) NM_198022 trinucleotide repeat containing 6C Gene [Source:MGI (curated);Acc:Tnrc6c-001]


Sequence tag IST14653D6BBF1
Sequence
ACATGTAATAAATAAATCTTTAAAAATAAAAAAATAAAAAAATAAGCAAATATATATGCTCCAGAACAGTTGATAGATAT
TTGCCCAATTTCTATAATGAAACTTAGCAATAGAAAAAGTTTCTCTGACTAATTATAACTACAGTCAAAACACATTACTA
CTAAAAAACATTTACTGATAGTTTCCATAGAAAATACATATGTGGGCTGGCGAGATGGCTCAGTGGGTAAGAGTACCCGA
CTGCTCTTCCAAAGGTCCAGTGTTCAAGTCCCAGCAACCACATGGTGGCTCACAACCATCCGTAACAAGATCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 117545156..117545469 314
NO GENE  


Sequence tag IST14653D6HMF1
Sequence
ACATGTAATAAATAAATCTTTAAAAATAAAAAAATAAAAAAATAAGCAAATATATATGCTCCAGAACAGTTGATAGATAT
TTGCCCAATTTCTATAATGAAACTTAGCAATAGAAAAAGTTTCTCTGACTAATTATAACTACAGTCAAAACACATTACTA
CTAAAAAACATTTACTGATAGTTTCCATAGAAAATACATATGTGGGCTGGCGAGATGGCTCAGTGGGTAAGAGTACCCGA
CTGCTCTTCCAAAGGTCCAGTGTTCAAGTCCCAGCAACCACATGGTGGCTCACAACCATCCGTAACAAGATCTGACGCCC
TCTTCTGGTGTGTCTGAAAACAGCTACAGTGTACTTACATATAATAAANAAATAAATCTTAAAAAAAAAGAAAATACATA
TGTAAAAGTTGTTTCNNNAAATGTTTGAAAAATCCTATTNANGTATTTTTNAATTTTATTTTCNATTCTGCNTCAGANTC
ANANCANAGGNAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 117544975..117545469 467
 
EST/CDNA Est Name
  CK345754.1

 
Come back to gene CK345754.1


For any suggestions or comments, please send an email to unitrap@crg.es