Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14566F4
Clone ID IST14566F4
Vector VICTR74
Project tigm

Sequence tag IST14566F4BBF1
Sequence
AAATCCTAGCAACCACATGGTGGCTCACAACCATCCATAATGAGATCTGTCGA
Sequence Type genomic DNA
Unitrap ID UNI30597 UNI30754 UNI31097 UNI31098

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 74854390..74854441 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 81199376..81199427 50
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031684 (Slc10a7) NM_029736 solute carrier family 10 (sodium/bile acid cotransporter family), member 7 Gene [Source:MGI Symbol;Acc:MGI:1924025]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 48701366..48701417 50
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000043505 (Gimap5) NM_175035 GTPase, IMAP family member 5 Gene [Source:MGI (curated);Acc:Gimap5-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 87624136..87624187 50
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030528 (Blm) NM_001042527 Bloom syndrome homolog (human) Gene [Source:MGI Symbol;Acc:MGI:1328362]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 40560229..40560280 50
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025757 (Hspa4l) NM_011020 heat shock protein 4 like Gene [Source:MGI Symbol;Acc:MGI:107422]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 18578412..18578463 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 72492856..72492907 50
NO GENE  

 
Come back to gene ENSMUSG00000025757


For any suggestions or comments, please send an email to unitrap@crg.es