Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11385G8
Clone ID IST11385G8
Vector VICTR76
Project tigm

Sequence tag IST11385G8HMR1
Sequence
CAGCGGGTACCCTTCGTTTTTCTTCNTCTTATTGTGAATCGGGTCTGGTTTTCGTTGATGTCACAGAACACAGATGAACG
CTCAAGTTTTTAAGGAGTTAAAAAGTTCCTAGTGTGAACCAGGCTACATACAATCAAGCTCAGTACTCTCAGCTCTGGGC
CGACTCTCGTTCCGTGCATTTAAATAGTTGTCCAAAAACAGATTTTAGTCGGAAACTGCTAACTTTGGAAGTTCGCAAAT
AAAATGAAAGTGAGTTTANAAGCCTTTCGGAACGCGTATTTANTTACAGCATTTTGTTGCACAGGCGTCTGGTTTCTGGT
CATTCNTGATANTCNAGCGTGTTTANCNNNGNNNAAACCN
Sequence Type genomic DNA
Unitrap ID UNI20609

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 3324167..3324511 333
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024900 (Cpt1a) NM_013495 carnitine palmitoyltransferase 1a, liver Gene [Source:MGI Symbol;Acc:MGI:1098296]

 
Come back to gene ENSMUSG00000024900


For any suggestions or comments, please send an email to unitrap@crg.es