Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10929G4
Clone ID IST10929G4
Vector VICTR76
Project tigm

Sequence tag IST10929G4HMR1
Sequence
TTGGGGGGACAGGCTCTTCATATCTTTTTGAGACAAGATCTCAGGTGGTCCAGGCTAGCCTCAGACTTGCTCCAGTAGCA
AGGATAATCATGACCTTAGGATTCTTCTGCCTCTACCTCCCTAGTGCTGGGATGACAGACATGTGCCGTCATGCCAGGTG
TGTGTGTGTGTGTGTGTGTGTGC
Sequence Type genomic DNA
Unitrap ID UNI22346

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 33777960..33778141 182
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000004768 (Rab23) NM_008999 RAB23, member RAS oncogene family Gene [Source:MGI (curated);Acc:Rab23-001]


Sequence tag IST10929G4HMF1
Sequence
CAATAACCNACAGGGCCGCATCTTGAATCTCAAAGGTGTTTATATATANTCATGGAAGACAGTTATCAACATCTCAAACT
GTTACACTAAAATGGCATTCTGAAAACAGTGATTTCTAGGAATCANGAATAAGAGGTAAGATATAAAGAGACAACATGAG
GTTTTAACAGGTANCAGGACTGGTTTCATATCCTGACCNGATATATGAATCTAAAACTNTCNNNATGGTTATTTGGGTTT
TTTTTTTNNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 33777716..33777962 229
NO GENE  

 
Come back to gene ENSMUSG00000004768


For any suggestions or comments, please send an email to unitrap@crg.es