Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14422G12
Clone ID IST14422G12
Vector VICTR74
Project tigm

Sequence tag IST14422G12HMR1
Sequence
CCAGAGCGGTTCAGTAACGGGGGTGGGGTGGGGGTGN
Sequence Type genomic DNA
Unitrap ID UNI29473

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 30971967..30972002 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075415 (Fnbp1) NM_019406 formin binding protein 1 Gene [Source:MGI (curated);Acc:Fnbp1-001]


Sequence tag IST14422G12HMF1
Sequence
CTGAGAAGCAGGATAATGAGTGGCAGATGCTCTGCAAGAAGACTGCAACTGTCATCAATGAAAGTCTGCTGCTCTTGAGA
AGCTAGTAAACATCTAACTCATGGGGCGGGGGATGTGGCTCAGTCAGTGGAGCACTGGCCTAGCATGCACAAAGCCCTGG
GTTCCATCCTCTGCACTGCATAATCCAGCTGTGGTGGTATTCCTAGCACTGGGAGGTGGAGAGAGAAGGGTCANCACTTC
AAAGTCATGGTCTCANCGGTTAAAAGCACCCGANGCCCTACCAGANGTCCCAGGTCTGATTCCCAGCACCCAAGTGGCAG
CTCTCANCCATCAGCCNTGGGTAACTCTAGTTCCAGGGAATTCGATGTGCTCTTCTGGCCTCCACAGGTACCANGCANGC
ACGTGTGGCAGACATAAATGTTCNANGCNNNTTGGGAATACANGNNACTNTCCNTANAATCCNNANCNTNTNNNNTANGA
AGAAANTTNTCCCTGANCTNTCNCCTGGTNNTTGNANNNGNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000075415


For any suggestions or comments, please send an email to unitrap@crg.es