Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D026H06
Clone ID D026H06
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D026H06
Sequence
AGCAGAAAATCTCTGAGCCCTGGAGTCTGCAGAGATAGCAACACCAGCTACACTGAAACCAAAGATCCCTCTTGTGGTCA
GGAGGCTGCAGCTCCATCTGGNNCACAGCTGCAGGTCCTTGACCCAAAGGAGAAGNGTAGCACGTTCTCAGCGTCTGTCC
GGGGGAGGCATCTGAGCCATCCTGAGCCAGAGCAACAGCACGTGATCCAGAGGTTGCAGCCGGAGCAGGGGAGCCCAAAG
AAGTGTGAAGCTGAAGAGGCAGAGCCAACAGCTGCCACACAGCCTCAAACCTCAGAGACTCAGATCTCTCATCTGCCAGA
ATCAGAAAGGACTCATCACACTGT
Sequence Type mRNA
Unitrap ID UNI10852

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 55281005..55282642 202
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022185 (Acin1) NM_023190 apoptotic chromatin condensation inducer 1 Gene [Source:MGI Symbol;Acc:MGI:1891824]


SPLK-Sequence tag 5SD026H06
Sequence
TGTTGGAGGGGTTGGTTTGAGTTGTTGTTGTATTTTGTAACACAACATGCCCTAGTCTCTCGTGTACTAGGGTTGTAGTA
GGACTGAATCTTTTGTTAAGGTCTGTTTCACACTCACATCTGCTTGTGTGGAAGATGGCCGAGATGCCTGGTCTTTGTTG
TCTCCCAGCCTCACTGTTGGGCTTACCTCATCTACCCTGACCCCAAGGAACACCTTTCACCTGCAGCATCCTGTCGACCT
GGATGCCTTCAGGCCTTAGCTGTGCATGTCCACTTGTCTTCTCCTCATTGGTGTAGGCAGGCACCCTGGGGCTGAGTGGG
CTTGTTAACGACTGGGAACTCTGGCTCTCTTCAGAGACATCCACCTTTCCTCTGATTTGGAAAAGAAACTCTCCCAGACT
TATCCACTTCCCTCCAACTTTTCTAGAAAACAGAGAGAGAGGTTCCACGTGATCATTGGCAGAGGTGAGCAGCGAGTTAG
TTAT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 55272928..55273411 480
NO GENE  

 
Come back to gene ENSMUSG00000022185


For any suggestions or comments, please send an email to unitrap@crg.es