Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D027A12
Clone ID D027A12
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D027A12
Sequence
GCTTTCAGAATTTCACCCGGGTTCTGNNTGNNCTCAAGAAAGGAGAACTGGATCTGAACAGTTTCACTCAGGGCACTCNC
CGGTGGATCATGATTCCTTGGAGTCCAAGCGCCCACGCCTGGAGCCAGTTTCTGATGCCCATTTCCAGCGTGTTAGTGCT
GCGGTTTTACCTTTAGTTCACTCGCTTCCAGAAGGCTTGAGGTCGTCTGCAGATGCTAAGAATG
Sequence Type mRNA
Unitrap ID UNI10810

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 62236378..62247094 180
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018501 (Ncor1) NP_035438 nuclear receptor co-repressor 1 Gene [Source:MGI (curated);Acc:Ncor1-001]


SPLK-Sequence tag 5SD027A12
Sequence
GATCTCTTNNNNTAACTTAGTTTTACAAATAAAAATCTTGTATTAAGCTTTTCATTTCTGTATTAGTCTTTCTCTTCATC
CCAAAGAGATACTCTGTTAGAAATGTTAATACTATTCGGGTGACATTCAGGTGTGTCTAACCTTTTGACATCTGTCANNN
CTTAGTCTCGTCACGTCTCTAGTGCTTCATGCGTGGCTATCCTGGGATGCATATTGTGGGCATGCTGAATATTGTTCTGG
AATAGGTAGAGTGGGCAGCAATTCATTTTGGAAGTAAGTATGACCTTTCGCTCACTCTGATGTCTAATAGGGGTGTTAGC
AAAGGTTTAAATGTCACTTAACAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000018501


For any suggestions or comments, please send an email to unitrap@crg.es