Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14409H9
Clone ID IST14409H9
Vector VICTR74
Project tigm

Sequence tag IST14409H9HMF2
Sequence
NTCNNACTTTTTCCTTATGCTTTTAAACGGCACACTCTGAATTGGTCANTCTAAATTCNTTTGGTGTAATTAAATCTTAA
TTAAAATGCATAANAAATGAAAAATATAACCAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14409H9BBF1
Sequence
TGATGACAATTCAGTATAAATCCTCAGTCTTGCCATTGTGTGAATCCTTACAGAGCCAGCTTCGTTCTCCTCCAGTATCT
TCTCTTANAGTTGAACCTGACTTTATTACCAGTTTTCATCTGGATCT
Sequence Type genomic DNA
Unitrap ID UNI16383

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 152628334..152628459 124
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000007659 (Bcl2l1) NM_009743 BCL2-like 1 Gene [Source:MGI (curated);Acc:Bcl2l1-001]


Sequence tag IST14409H9HMR1
Sequence
NNNACCTTGATGGTGTCTGCTAGCTGCTTATTGGACAGTCCTCTTTCTCCTCTACGTGACTGGATTGCAGTTTATCACCG
GCCTTACACCACTACGGTCTATGGATAGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 30989980..30990086 107
NO GENE  

 
Come back to gene ENSMUSG00000007659


For any suggestions or comments, please send an email to unitrap@crg.es