Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15033H5
Clone ID IST15033H5
Vector VICTR78
Project tigm

Sequence tag IST15033H5HMR1
Sequence
CACTGACCTGCCTCAACCAAATTGTCNCTTTTTATAATTGCACTGTAATTCATTCTCGGGAACTGAATGANAAATGATGT
ACCTTGGACCCAGGCTTCTGGATCAAGTAGCACCATGTCCTTGAAGTTC
Sequence Type genomic DNA
Unitrap ID UNI30846

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 103703778..103703905 124
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034751 (Mast4) microtubule associated serine/threonine kinase family member 4 Gene [Source:MGI Symbol;Acc:MGI:1918885]


Sequence tag IST15033H5HMF1
Sequence
AGATTATTTAATTTTTTTTTAGTTATTCACTTTACATCCTGCTCACTGCCCCCTCCTGATTACCCCCTCCCTCAATCTTT
CCCCCTCCCCTTCTCCTCTGGGCAGGTGGGCCCCCCCTGGGNCACNCACACACACACACACACACACNCTNTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 181334431..181334580 144
NO GENE  

 
Come back to gene ENSMUSG00000034751


For any suggestions or comments, please send an email to unitrap@crg.es