Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P149G05
Clone ID P149G05
Vector rFlpROSAbetageo
Project ggtc

Sequence tag P149G05
Sequence
TGAGGCGGAGCGGGCAGGACGCCTGGGACGGCGGAGGCTCGAGCGTGCCAG
Sequence Type mRNA
Unitrap ID UNI10883

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 21602926..21602976 51
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032194 (Kank2) NM_145611 KN motif and ankyrin repeat domains 2 Gene [Source:MGI Symbol;Acc:MGI:2384568]


SPLK-Sequence tag 5SP149G05
Sequence
GGAGCCACCTGNNNTGGGGGCCATGTGCAGGCTGTGGGAACAGCTGGAGCCTGTCCAGGGCTGGACAGATGTGCACACAG
TCAGGGAGGTTTGGTTTCTTTGTTCTAGGGCTTTCTACAGCCAGGCAATGGTAGTGAAGGAGGCTGGTGTCGACGCTAGT
GGCCTGACCTGGTCAGAGTGCTAGACCATCTGTGGAGGGTGGGTGGCCGCATCTCCTTCCTTCTCCCTGAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SP149G05
Sequence
CAGCCTCAGNNTTCAGCAGGCTGTTGGGGAGACTCAGTTCCCTGAGTGACATCTGAGGAGCCNCCTCANAGAGAGGCTGG
CCCAGGTCCTGCACATGCCCGCCCCATTCTCAGGCCAGGGGATGATCGGAGGGGAAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000032194


For any suggestions or comments, please send an email to unitrap@crg.es