Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11564A7
Clone ID IST11564A7
Vector VICTR76
Project tigm

Sequence tag IST11564A7HMR1
Sequence
NTCTAGCTGAACGAACAGCTATGACAACCGGAGCTATTTAAATGTTTTTCAATTCTAGGTTTATGGCGTAAAGCGTCCTT
TTTAAAATATAGATATTCCAAGGTTTCTTGGTACCAAGTAATTAACAGTTTTGCATTTTAGGTTTTTGTTTGTCTATTGT
TTGTTTTAAGCCAGTTAAGCATGTTTATTGAGCCTGGATCACTGGGCGTTGANAACTGGAAACAAAAACTGCTATTGTTT
ATTGANGCTTTTTCCTTTGGTTTCTAAATGTTAGGGTTGCGAGTGTGTTC
Sequence Type genomic DNA
Unitrap ID UNI3005

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 149362669..149362956 284
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001687 (Ubl3) NM_011908 ubiquitin-like 3 Gene [Source:MGI Symbol;Acc:MGI:1344373]

 
Come back to gene ENSMUSG00000001687


For any suggestions or comments, please send an email to unitrap@crg.es