Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D028A02
Clone ID D028A02
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D028A02
Sequence
GAGTNNNNCCATCTAAAAAGGGAGGGGTCCAAGGAGCTGAACTCCTAGCCGCCTAGATTTCCACTGTGGCTCTGGGTACG
AGTGGCAGTTTCTTCTTGGGATTTCAGAAAGGAAACCAAGGAGGAAATAGAGCGCACCGCATCGCTGTGGGCATTAGAGA
AATGGACTAAGAGCTGGGACACGTGGCAAAAGAAGATAGTCTTCTTCTCTCAATAGAGTGAGTGTGCAGTGCACCCAGCA
G
Sequence Type mRNA
Unitrap ID UNI369

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 44389830..44392347 135
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051176 (Zfp42) NM_009556 zinc finger protein 42 Gene [Source:MGI Symbol;Acc:MGI:99187]

 
Come back to gene ENSMUSG00000051176


For any suggestions or comments, please send an email to unitrap@crg.es