Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10252B2
Clone ID IST10252B2
Vector VICTR76
Project tigm

Sequence tag IST10252B2BBF1
Sequence
ATAATGTGTTTTAATGAACAGAATAATGTTTTGGTATGCCAGGCTTTTTAAGAGAAATAATATAATGCAACTTTCCAGGT
ATGAAAGCAGACCGTTGTTACCAAATCGGACCCCACCTTGCACAAGGCTGGCCTTTACCAGTAATAATGAGAATGACGGG
GCTGGAGAGATGGCTCAGTGGTTAAGAGCCCTGACTACTCTTCGGGAGGTCCTGAGTTCAATCCCCANNACGTTTTTCTT
TAATGTTTATGATTAATACCNCNNAACAATTCCTAAGTTCTTTCCGATGTGTANAGCACTCTCCNNGCTTGTCANGAATG
TATGAGAAAAGTANCTTCACGGCTAGGGTCTGTGACCCTCTTCCTTTATCCNCAAGGTCTNATCTCANGANGACTGGGCT
TACAACAGCCGCTTCTCCCTTCATCGGCAGCATCATGAAGATGGCAACCATCANATGCTGCACCNNGTCAAGANGCATTT
CANACTCCCCNNNGGN
Sequence Type genomic DNA
Unitrap ID UNI1683

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 135217348..135217837 452
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028164 (Manba) NM_027288 mannosidase, beta A, lysosomal Gene [Source:MGI (curated);Acc:Manba-001]


Sequence tag IST10252B2HMF1
Sequence
ATAATGTGTTTTAATGAACAGAATAATGTTTTGGTATGCCAGGCTTTTTAAGAGAAATAATATAATGCAACTTTCCAGGT
ATGAAAGCAGACCGTTGTTACCAAATCGGACCCCACCTTGCACAAGGCTGGCCTTTACCAGTAATAATGAGAATGACGGG
GCTGGAGAGATGGCTCAGTGGTTAAGAGCCCTGACTACTCTTCGGGAGGTCCTGAGTTCAATCCCNANAACGTTTTTCTT
TAATGTTTATGATTNNTACNNNNNAACAATTCCTAAGTTCTTTCCGATGTGTAGAGCACTCTCCANGCTTGTNANGAATG
TATGAGAAAAGTAGCTTCACGGCTAGGGTCTGTGACCCTCTTCCTTTATCCACAANGTCTCATCTNANGANGACTGGGCT
TACNACAGCCGCTTCTCCCTTCATCGGCAGCATCATGAAGATGGCAACCATCANNTGCTGCACCANGTNNAGANGCATTT
NNAACTCCCCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000028164


For any suggestions or comments, please send an email to unitrap@crg.es