Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D028D03
Clone ID D028D03
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D028D03
Sequence
CCTTCCCGCGGCGGGGATGCGGCCTGGAGCGAGGCTGAACCCGGGTCCCGGTCCGCGGCGGTATCCGCCTCGTCCCCGGA
GGCAAAGGATCTCAACGGAGGGCTGCGGAGGGCCTCCTCCTCCGCGCAGGCCGTGCCTCCCAG
Sequence Type mRNA
Unitrap ID UNI10886

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 88374604..88374745 140
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005370 (Msh6) NM_010830 mutS homolog 6 (E. coli) Gene [Source:MGI Symbol;Acc:MGI:1343961]


SPLK-Sequence tag 5SD028D03
Sequence
GATCTCTAATTTCTTTCCTTCCCTTTGGCTATAAAGGACACAGTTCAGACACAGGTAAACACAGAGGT
Sequence Type genomic DNA
Unitrap ID UNI10886

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 88375537..88375604 68
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005370 (Msh6) NM_010830 mutS homolog 6 (E. coli) Gene [Source:MGI Symbol;Acc:MGI:1343961]


SPLK-Sequence tag 3SD028D03
Sequence
GGCTTCAGAGGGATAAGGGTGCGCACCACGCCTGGATACCCCGACTTATTTATTTTCTTTCTTTCTTTCTTTCTTTCTTT
CTTTCTTTCTTTCTTTCTATCTTTCTTTCTTTCTTTCTTTCATGTGTGTGAGTACACTGTTGCGGTCTTCAAACACATCA
GAAGAGGGTATCAG
Sequence Type genomic DNA
Unitrap ID UNI10886

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 88376049..88376214 142
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005370 (Msh6) NM_010830 mutS homolog 6 (E. coli) Gene [Source:MGI Symbol;Acc:MGI:1343961]

 
Come back to gene ENSMUSG00000005370


For any suggestions or comments, please send an email to unitrap@crg.es