Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14876G12
Clone ID IST14876G12
Vector VICTR76
Project tigm

Sequence tag IST14876G12HMR1
Sequence
CTTCCCCTGCTTGCTTTCCTACCCCCAGCCCCAGGNCAATTTTTCCTAAATCTTTCTGATATGATAATTGAGTGAATGAT
CCAACAGATTCAGAGTTCCTTGCATGCCATTCTGTCACCCTTGTAATCTCAAGGGTTCTTAGTGGAGAAAATGGTATTTC
AGGAGTTCNAGTN
Sequence Type genomic DNA
Unitrap ID UNI15573

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 120486542..120486713 168
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032897 (Nfyc) NM_008692 nuclear transcription factor-Y gamma Gene [Source:MGI (curated);Acc:Nfyc-002]


Sequence tag IST14876G12HMF1
Sequence
GAAGAAGAGAATGAATGCAGGCCTATTACTCCTTTAAAAACTCCTGACCTGAACGAGACCAGATTCCTCGTAACCACTGG
ACTAGAACACCCAGAAGTAGTCTTTCATTTTAAGAGAGCTTTTCAGTTCCAATCTGCATAAACAAACTTTGTCCTTCAAT
CTTTCAACTCCTCAAGGTCACTTTTCAGAGCAGCGGCAGAGGCCTGCATCCAGGAACTTGGGCTGTTACCCAACTCCNNC
TGCACATATNTNCACTTACNNCCNNAATGGATCCTATCNNGTNAACCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 120486710..120486996 265
 
EST/CDNA Est Name
  BY212728.1 - BY767152.1 - BY041319.1 - BY047453.1 - BY041913.1 - AW259876.1 - W76961.1 - BG801321.1 - BY085107.1 - BY118612.1 - BY332722.1 - CO812435.1 - BY120857.1 - BY005484.1 - BB843275.1


Sequence tag IST14876G12BBF1
Sequence
GAAGAAGAGAATGAATGCAGGCCTATTACTCCTTTAAAAACTCCTGACCTGAACGAGACCAGATTCCTCGTAACCACTGG
ACTAGAACACCCAGAAGTAGTCTTTCATTTTAAGAGAGCTTTTCAGTTCCAATCTGCATAAACAAACTTTGTCCTTCAAT
CTTTCAACTCCTCAAGGTCACTTTTCAGAGCAGCGGCAGAGGCCTGCATCCAGGAACTTGGGCTGTTACCCAACTCCAGC
TGCACATATCTACACTTACAGCCCCAATGGATCCTATNAGGTAAACCCTTCCCTCAAGAGGAANCAAGTGANNGCAGACC
AACACCTTCCAAGTTCTCCTCAGCCNGGCCTGCTCCTTTTCCTGTCCAGGGACGGCTGCTGCCTCACTGCTCTAACTGAT
CTGCAGCANGAATGTTCNANTGANCTTCATCCNNCATTNNNAANTNAAGAGAAAACAAAGAATTGNTTTTNNAAAAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 120486710..120487185 438
 
EST/CDNA Est Name
  BG975399.1 - BI734356.1 - CF900055.1 - CF901574.1 - CF893513.1 - CJ092564.1 - CF900981.1 - CF902537.1 - CF901577.1 - BU502938.1 - CK621495.1 - CN690357.1 - BF138656.1 - BI148886.1 - CA530369.1 - BY212728.1 - BU152222.1 - BY767152.1 - BY041319.1 - AI891686

 
Come back to gene BG975399.1 - BI734356.1 - CF900055.1 - CF901574.1 - CF893513.1 - CJ092564.1 - CF900981.1 - CF902537.1 - CF901577.1 - BU502938.1 - CK621495.1 - CN690357.1 - BF138656.1 - BI148886.1 - CA530369.1 - BY212728.1 - BU152222.1 - BY767152.1 - BY041319.1 - AI891686


For any suggestions or comments, please send an email to unitrap@crg.es