Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14830F9
Clone ID IST14830F9
Vector VICTR76
Project tigm

Sequence tag IST14830F9HMR1
Sequence
CTGGAAGCTTTGGGGATCTCCACGGGTCTCTCAGACCCTCAGCTCTGCAAGGCCTANACGGGAGGCTCTGGATCCTATGG
AAGGAATAGGAAGGAAGTGTGCTTTGTCTCANCCTCCATGGGAAGCANATTCCGGTGCACCANTCCTGGGAGTCCTGANA
GAANAACN
Sequence Type genomic DNA
Unitrap ID UNI31115

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 74371979..74372145 155
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038807 (Garnl4) NM_001015046 GTPase activating RANGAP domain-like 4 Gene [Source:MGI (curated);Acc:Garnl4-001]


Sequence tag IST14830F9HMF1
Sequence
CCAGAAAGTGAGTGGGGTAAAGAAGGGAGAATTGAGCCTAGAGTGGCAGGCCACAGGCAAGCAATCCCATCCCGCTGCAC
TCCTGTCCTCATCTTCCTCACTGACACAGTTAGCTATGTCCATCCCACTCCACGACTCCACCANCCACATANAAGACACC
CTCCCCGGGATCCAGGGATCAGCTGAATCTTGCTTANAGTTAGCTGTCTCACACCCACCTGAAAANGTGCCCCACTCCCN
NNANCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 74372142..74372380 227
 
EST/CDNA Est Name
  CJ120669.1 - CJ120847.1 - AW457490.1 - BB862037.1

 
Come back to gene CJ120669.1 - CJ120847.1 - AW457490.1 - BB862037.1


For any suggestions or comments, please send an email to unitrap@crg.es