Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P147F02
Clone ID P147F02
Vector rFlpROSAbetageo
Project ggtc

Sequence tag P147F02
Sequence
CTGGCTCTACGGGTTGGCGCGAGAGTCAAAAGGCTCGCATCGCTTTTGCGCAAGATGGCTGCTGCGGGGGCATTCGCGTA
CTGATTTCTAGCGCGGGGATGGAGACGTGTAGACTGAGTTCGAAACGAAG
Sequence Type mRNA
Unitrap ID UNI6398

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 180444615..180444744 126
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038914 (Dido1) NM_175551 death inducer-obliterator 1 Gene [Source:MGI (curated);Acc:Dido1-002]


SPLK-Sequence tag 5SP147F02
Sequence
ATCTCCGGTTGTCTTGTGTAGTCCAAGATGGTCTGGGTCTGGGAGGCTGTGGAGCCCTTGATTCTGATGCGGAATGAGGC
TGGTGGCGTCGCTAGTGGGCAGGTTCTCGACACTTGCGGTAGGGCATTCGTGGTAGGACGTGACTGGGNNTGGGCGCGAA
TTTGCGGGTGTAC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000038914


For any suggestions or comments, please send an email to unitrap@crg.es