Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D028G05
Clone ID D028G05
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D028G05
Sequence
CCCNNNCCCCCGGGCCTTCGGCCGAGCCGGAAGACCTTTCCCTTCGCGGTTTCGAGAGCTCCGTTTTGCAGAACCTGAAA
GGGAGATTCTGGACGGTCCCGGGGACTCTAGACTGTCTGTCCCACGACCTGTTCTTGGCGTTATG
Sequence Type mRNA
Unitrap ID UNI4900

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 84361906..84362039 126
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035762 (Tmem161b) NM_175187 transmembrane protein 161B Gene [Source:MGI Symbol;Acc:MGI:1919995]


SPLK-Sequence tag 5SD028G05
Sequence
AATTCTTGTAACATTTAAAGGTTCTAAATCACGATAATTCATTTTTCCGATAATGTGCCTAAGCTTGTTGTCACTCTNNC
AGACTTACAGTCACTTGGATAATGATCCATGCAATACCTGTGTTCTGCTTTTAAGCAAAATTCTCTTAAGTAGGAGGTGC
TCCCTCCTATGGCTTACATACTCTGCCCGAGCTAATTTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000035762


For any suggestions or comments, please send an email to unitrap@crg.es