Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10309H2
Clone ID IST10309H2
Vector VICTR76
Project tigm

Sequence tag IST10309H2BBF1
Sequence
GCTCCATGGTCTAAAAAGTGTAAGGACCTGAGTTCAAGTTCCCAGAACTGGAGATTACAGCATGGTTATCTGTAATCCCA
GCATGCTTATGGGAAGTGCAGATAGGAGAATTCCTGGAAGCTCAAGGACCACCTTGCCTTTCCCGGAANAAGCCACAGTT
TGAGGGTGGGGTGGGTATTATAGGATGGAGCAGAAAGGTTGTGAATTATCAATAGGCTTTCTGTCACCTTTTCTCGTGGA
ACCGGTTTGGTTCCTCTGCTCCCAGGCACCANATACAATCTCTACTTCCTTCTGACCNCAGTTCCTCCTGCTCAGGCCTT
TACAGCCCCANGGGTCTCCCTGGCTTTCAAACAAATAAGCACATTCCTGCCTTGANAGGCCTTTGCAATTGCAGTTCCGG
GAACACTTTTCCCTCACCCATTCCCTCANGCATAGCCTCTTCCCTCACGCCCTTCACGTCTTCACTGTCTTTGNNAAAAT
ATCATTTTTTTCTCTGANGACTTTGGTGANCNCTGNATCTAAAATTTCNTCNCGTNCN
Sequence Type genomic DNA
Unitrap ID UNI30521

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 34377050..34377584 507
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006423 (C330007P06Rik) NP_084227 RIKEN cDNA C330007P06 gene Gene [Source:MGI Symbol;Acc:MGI:1924894]


Sequence tag IST10309H2HMF1
Sequence
NCTCCATGGTCTAAAAAGTGTAAGGACCTGAGTTCAAGTTCCCANAACTGGAGATTACAGCATGGTTATCTGTAATCCCA
NCATGCTTATGGGAAGTGCAGATAGGANAATTCCTGGAANCTCANNGACCACCTTGCCTTTCCCGGAANAAGCCNCAGTT
TGAGGGTGGGGTGGGTATNATANGATGGANCANAAAGGTTGNGAATTATCAATANGCTTTNNGNNNNCTTTTCTCGTGGA
ACCGGTTTGGTTCCTCTGCTCCCANGCACCAGATACNATCTCTANTTNNTTNTGANNNNAGTTCCNNNNGCTCANGCCTT
TACAGNCNNANGNGTCTNNNNGNNNNNNANACAANTAANCACATTCCTGCCTTGAGANGCCTTTGCNNTTGCAGTTCCGG
NAACACTTNTCCCTCACCCATNCNNTCNNCATANCCTCTTCCCTCACGCCNNTCANGTCTTCACTGNNTTTGCNAAATAT
CANNNNTTTCTNTGANGACTTTGGTGANNNCTGNNTCTAAAATTTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000006423


For any suggestions or comments, please send an email to unitrap@crg.es