Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D028H06
Clone ID D028H06
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D028H06
Sequence
AGGGCTTAAGGAAGTAAAATGGCGGACCTGGCGAACGAAG
Sequence Type mRNA
Unitrap ID UNI6726

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 56812795..56812834 40
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002372 (Ranbp3) NM_027933 RAN binding protein 3 Gene [Source:MGI Symbol;Acc:MGI:1919060]


SPLK-Sequence tag 5SD028H06
Sequence
GGTCCTTTGAGGTGCACTTGATGCCCCCCATTTAGGCCTGGCCATCTGATCTTGAAACTCCTAACTGCTTCTTCACATCC
CGTTTTTATTTTTGACACCGTGAAACCTCCCCTCTGGAGTCGACATGTCGCTGAATGAGTCTGGAGTCGACACTAGTGGC
CAGTTGTTGCAGAACCTGCACTCTCTTCCTAC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SD028H06
Sequence
ATATACTAATTGCTTCCACACCCCCTTTTGCCCCGTGGCCCTGACTCCCTGAGCACTCTGGGATGTAACACTTTCTCAGT
CAGCCTGATGCTTGACACCCAGTGGTGGCCCCTTCGNNNNTCTTCCGGGGTTCAGTTGGGGGACTTCAGGG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000002372


For any suggestions or comments, please send an email to unitrap@crg.es