Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13802E6
Clone ID IST13802E6
Vector VICTR74
Project tigm

Sequence tag IST13802E6HMF1
Sequence
ACCTTTCTGTGAATAAATAAGCATATCTATGAATGCCTGTTTCTGAAAGAAAACACATTGTCAGACATAGAGGGCTTGCT
TTCNTCTTCTGTCTCTTATAATTCTTTTTTATGATCCTGCCGGTGGCC
Sequence Type genomic DNA
Unitrap ID UNI22725

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 71120980..71121106 125
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000003279 (Dlgap1) NM_177639 discs, large (Drosophila) homolog-associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:1346065]

 
Come back to gene ENSMUSG00000003279


For any suggestions or comments, please send an email to unitrap@crg.es