Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D029F11
Clone ID D029F11
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D029F11
Sequence
GCAGAGACAGAGGNAATCTTATCGTNNNCATCNNAAGAACCCTTCGCTTCCCNNNGACATACATGTGTAGGTGTGAGAAC
NNGCGGCGGCGGCTGTAGCGGCGGAGGCTTCGGCGTCGGCGACAGCGACAGCGACGGGATCTGGTGACGTCTTCTCTGAG
GG
Sequence Type mRNA
Unitrap ID UNI6910

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 155970688..155970767 74
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044150 (A830080D01Rik) NM_001033472 RIKEN cDNA A830080D01 gene Gene [Source:MGI Symbol;Acc:MGI:2685992]


SPLK-Sequence tag 5SD029F11
Sequence
AAATTTATACATCAGAAAACGTGTTTCCTTGTTGGCAGTTATG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SD029F11
Sequence
GTAATCTTTGTCAGCTGTTATATCCCTTTGCAAACCCTGGTCTCTGAACTTAACCCTGGAACTTTATGGGGTCAATTAGG
GGTTTCCTTGCAGTACACTTTGAAGTTCTTGGGAAGAAAATTTAACCCAACCCATATTTCTTTCTGTCCATTTCTGTCAA
AANNAATAGTGTACTTTAATGTATGGCCAAAGTGAACATTTCGAGCAGCTCACTTGATGCTGCGCTTCAGGACTTTTTCT
CATAAAAGCAAGAAGCCAGCCAAGTCTTCTTACCATCGAGTCGGCCGAGCACAGACCGAACGACTCTGAACTAGAGTTAA
CTCTCTAGAAAGCGTTTTCTAACCTAACTTGGACCTTTGTGATATTCTGAAGCTTTCTTGGTTTTGTCTTTCACTTTTCC
TTTTCTGTTTTGGAAAAAAATATGGA
Sequence Type genomic DNA
Unitrap ID UNI6910

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 155982901..155983326 408
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044150 (A830080D01Rik) NM_001033472 RIKEN cDNA A830080D01 gene Gene [Source:MGI Symbol;Acc:MGI:2685992]

 
Come back to gene ENSMUSG00000044150


For any suggestions or comments, please send an email to unitrap@crg.es