Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14332A1
Clone ID IST14332A1
Vector VICTR74
Project tigm

Sequence tag IST14332A1HMR1
Sequence
GGTTATGCTGAGATAAGATGGCATCCTATAGAAATGATACATCTAAGGTGTTTATGGTTTCGTATAGGATGTACATGCCT
TACTGGAAACATATTCTAAACAACTGGTCTACTCTAAATAGAGTTATTGCCCAAGATTGGAAGGGATTGGTAACAACTGT
ACTAGAGGCCGGTCANCAGTTGCAGTGGTTC
Sequence Type genomic DNA
Unitrap ID UNI18165

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 21160902..21161091 188
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020128 (Vps54) NM_139061 vacuolar protein sorting 54 (yeast) Gene [Source:MGI (curated);Acc:Vps54-001]


Sequence tag IST14332A1BBF1
Sequence
TTTGGTCTTTCATTTGGTCTTTCATTTGGTCTTTCATTTCATTTCTTTTTCTTTTTCTTTTTCTTTTTTCATTCAGTTAA
CTACTTGGCTAGTGAACTCAGTACCCATCAACTCCTCCTGATTAAGTGCTGGCTAGGCAAGCATTTTCTGTTGAGCAATT
CATCCCTCTGCCTCTTCAGTTTGTTTAGGTTTTTTTGGTTTTTGAAATCAGGTCTCCTTATTTAGCTCATTCTGGCTTCA
AGTTTGCCCAGAGTAATGAGGGTGGTGAGTGAATGAGTTAAAGGCAGACATTCATGACTTCAAAGTTAAATAGCAGTTTA
TTTCCTTTAATTTTTTTANATN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 148943612..148943923 300
 
EST/CDNA Est Name
  BE625982.1 - AI627130.1 - W09570.1

 
Come back to gene BE625982.1 - AI627130.1 - W09570.1


For any suggestions or comments, please send an email to unitrap@crg.es