Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12127C5
Clone ID IST12127C5
Vector VICTR76
Project tigm

Sequence tag IST12127C5HMR1
Sequence
AGCAGGTGGTTTTACTATTTTATTTTGCTTTTACACAAAGCTATGTTACAATTTTGAGTCAGTACTATGAGCCTTAAGTA
ATAAATGCAATCACTCCTCTTTTTTTGTTC
Sequence Type genomic DNA
Unitrap ID UNI12991

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 33941827..33941935 109
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027680 (Fxr1) NP_001106659 fragile X mental retardation gene 1, autosomal homolog Gene [Source:MGI Symbol;Acc:MGI:104860]


Sequence tag IST12127C5BBF1
Sequence
CTGCTGTTTTACTATCTGTGATGGTTAATACTGTCAACTTGACAGGATCTANAGTCACCTAGGGAACAATCCTCTAGCTG
TGTCTATAACAGAGCTGGGGACAATGACCCTAAGAAGTGCCATCTCATAGCCTGGGATCATGGACTGAGTACATAGGTGC
AAGTGAGCACAGCACCAGCATTCTCTTCTCTGACTGCACAGAACATGAACAGTAGCCTCAAGTTGCTGCTACTATGCCTT
CCCTACCAATATGAACCGTACACTCAAATTCTGGGCCAAAATAAACACATCTTTAAGTTACTTGTTANGTTTTTCAATGA
NGAAAAGTTNGTATACTATCCCGGCTCTATAAACCAGGCAAAAATGANNCTGGAAAAAAACTCTTTTAAAANNNNNNTAA
GCATANAAGGGTGTTACAACTTTNTTGCAAATTTAAAAATTTATACCCTAGCCTTCCAGTCTACCATCTTCANANNAATG
CATCTTCTNNAAGANTCNGNTTACAGTANACAGTGACNGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST12127C5HMF1
Sequence
CTGCTGTTTTACTATCTGTGATGGTTAATACTGTCAC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 33941796..33941831 36
NO GENE  

 
Come back to gene ENSMUSG00000027680


For any suggestions or comments, please send an email to unitrap@crg.es