Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10091E9
Clone ID IST10091E9
Vector VICTR75
Project tigm

Sequence tag IST10091E9BBR1
Sequence
ATCAGAAAGCATATTTGTGGTGAGTGCTGCTAACAGGGCCAGTCTGGTGAGGGCTGGGGGGCTGGGGAAGGGTTAGTAGC
TCGTCTAACACTGACACACTCTCCCTGTGGATAACAGACAGATTGGGACATCTTGGAGAGGACGTGGGTCACATGACCTC
ACACGTCCTCTGAGTTTCTGCCCAGCACCTTCCTTCTGAGAGACACAGAGAACGGATGTCACGCCTAACACTCATCTTTC
TTAGCAAACGACAGGGGTCTGTGTGGTTCAGCCAGTTTCACAGGTGCTGGGGGACGTAGCTTAGCCATAGAGCCACTTGC
TTAGAAAATGTTCTAAACATGGTTCCATCTCTAGCACTGAAAAAAAAAATAAAATAAAAACAAAATAAACAAACCCCAGA
AGACACAGGTGGAGAAGTAGGAGAACCATGGTCACTGCCACTGTCCCTAAAAGCCAGGAGACAGACACAGTAGGGAGCAT
CCTTGCCAGAGGGAAAGCTTCCCTGAGGACTGATCCACATGGCAATGTTGAGGGGAAATTACAAAGTGTAGATCCCTGGA
TGTTGACTGTGTTATTCAGCTTGTGTCCCTGAAGGGCTCCGGATCCG
Sequence Type genomic DNA
Unitrap ID UNI29935

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 148284899..148285504 602
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028977 (Casz1) NM_027195 castor homolog 1, zinc finger (Drosophila) Gene [Source:MGI (curated);Acc:Casz1-004]


Sequence tag IST10091E9BBF2
Sequence
ATCTTAATCACTGAACCGTCTCTCCAGCCTCAGTGTAATTTTTTTTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 80704753..80704798 46
NO GENE  

 
Come back to gene ENSMUSG00000028977


For any suggestions or comments, please send an email to unitrap@crg.es