Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D031A04
Clone ID D031A04
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D031A04
Sequence
CATGGCTGACAAGGAAGCGGCCTTTNNNGACGCAGTGGAAGAACGGGTGATCNNNGAGGAGTACAAAATATGGAAGAAGA
ACCCCCCTTTTCTTTATGATTTGGTGATGACCCATGCCCTGGAGTGGCCCAGCTTAACTGCCCAGTGGCTTCCAGATGTG
ACCAG
Sequence Type mRNA
Unitrap ID UNI10890

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 129011741..129012478 136
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000057236 (Rbbp4) NM_009030 retinoblastoma binding protein 4 Gene [Source:MGI (curated);Acc:Rbbp4-001]

 
Come back to gene ENSMUSG00000057236


For any suggestions or comments, please send an email to unitrap@crg.es