Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10511G12
Clone ID IST10511G12
Vector VICTR76
Project tigm

Sequence tag IST10511G12BBF1
Sequence
CCATACACGTGCATGCTCATGTATATCATATATACCTGATGATAAATACCAAAACATGGTACAAAAATAGTTATTACTCT
TCTCTCTTACCCTCTTCCCTCTCTGTCCCTTCTCTCCCCATTCCCCTCCCCCCTCTCTCCACGTGTTCATGGCCAGCCTC
TATTCTTCTCTCCCTCCCTCTCTCCCTCCTCCTCTCCCTCTTTCTCCCCCCTTCCCAACTCCCCTTCCTGTGTCTTAAAT
AAACTATATTACTCATTTCTTTATGTGCAACCTGTCAAGGTTGTGAAGGTTGGTAACTGGTTAAGAAAGAGCAGTTTTAA
AAGTCTGATTCCTTAGGGCATAGNCCAGTTTAGTAGTAGTGCCNAGTTGCTATATCATGTGATTGTTTGTCTCTGATTAG
CTACCTTAGTTTCTGGATTATAGTAGGGCTGCTAAGAAGTCCCCTGATCTCTTCATGGCTGCTTTCACATTCTGANGTGC
AGTNNGCTGGTTGAGTAGGATACATTGGAAAGTGNTGCTTGTCTCCCN

Sequence Type genomic DNA
Unitrap ID UNI14745

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 98634222..98634748 515
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031311 (Nono) NM_023144 non-POU-domain-containing, octamer binding protein Gene [Source:MGI (curated);Acc:Nono-001]


Sequence tag IST10511G12HMF1
Sequence
CCATACACGTGCATGCTCATGTATATNATATATACCTGATGATAAATACCAAAACATGGTACAAAAATAGTTATTACTCT
TCTCTCTTACCCTCTTCCCTCTCTGTCCCTTCTCTCCCCATTCCCCTCCCCCCTCTCTCCACGTGTTCATGGA
Sequence Type genomic DNA
Unitrap ID UNI14745

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 98634222..98634373 150
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031311 (Nono) NM_023144 non-POU-domain-containing, octamer binding protein Gene [Source:MGI (curated);Acc:Nono-001]

 
Come back to gene ENSMUSG00000031311


For any suggestions or comments, please send an email to unitrap@crg.es