Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10964G8
Clone ID IST10964G8
Vector VICTR76
Project tigm

Sequence tag IST10964G8HMF1
Sequence
NTCTCTCCTTCCCAGANCCCTGGGGTGCAAGTCGTGGTTGGCCGTGCTTGCTTTTTAATTAAATGGCTGCTGGGGGTTGA
ATACAGGTCATGCTTTTGCATCCACTGAGCCACCCACCCAGCCATCGGAAAGTGCTTGGGTCCCTTCTCTCTAGTTTACA
AGGTCATTTATTTTGTCCCTCATAGTAACAAAAGCTCTGCTTAACCCTGGGTTTAAAATCTCTCCTGAACACAAGCAGCA
CCTATCCACCGAAGCTGCTCCAAGAGTGCCTCACCCTGAATTTCTTGTGTGCTTTCCCTAACAGTCATGTCCAGAGAGTT
CATGAGGTTTTTTGTTTGTTTTAAAGTTAATATTTNACAAGAAGAAGACTCAAGAGAAACAGACATACAGAACATTGGAT
ATCTGGTTNAGTTACAGTTTGGGTGCTAGTGGTTGAACAATTGGAACATCTGCTGAACAAGTGCTCGACCACTGANCGAC
AGCCATGGACTCACACCAAAAGATGCNNGGTACACACTTGACNATTCCNTCCTGNCNGTGTGGGANCTCTGTAGTCCCTT
TNCTN
Sequence Type genomic DNA
Unitrap ID UNI31147

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 13106339..13106901 539
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042414 (Prdm14) NP_001074678 PR domain containing 14 Gene [Source:MGI (curated);Acc:Prdm14-001]

 
Come back to gene ENSMUSG00000042414


For any suggestions or comments, please send an email to unitrap@crg.es