Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10076E10
Clone ID IST10076E10
Vector VICTR75
Project tigm

Sequence tag IST10076E10BBR1
Sequence
TCTCCTGCGGCTGTTGGTCTTTCAGAGGCTAGGACAGCATCTGTCTACCCACTGGTGGGCAATGTCTGCAGAATTCTTTC
AGAGCTCACGTGTGGGGAGAGTGGAATGGGGACCTCTCCTGAATTCTAGAATCTGGATTTAGGGTGGGAGTTTCCTCTCC
TCCCCAGATCC
Sequence Type genomic DNA
Unitrap ID UNI11419

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 71025295..71025466 156
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022099 (Epb4.9) NM_013514 erythrocyte protein band 4.9 Gene [Source:MGI Symbol;Acc:MGI:99670]


Sequence tag IST10076E10BBF2
Sequence
GAGGTAGTTACCTGTCCACAGCCCCACAAGTAACAAACCTATCAATACTCCCTCCATATTGGCATTTCCCAAACCAATAG
CTTTCGTGTACAGTAGAAGCAGTTGAAAAGCACCTTAATTGCAAGGCCTGGGACAGAGAATCCAACACCGGAGGCGGCAA
CAGCAGCAGCAGCGGCAGTGGAGAGCTCAGAGAGAATCCATGTGGTGACATAAGACGGACACTCTCTACTCCCGAAGCCT
TGCTGCTTCCTTAGTTTAGAACAATCCAGGGAACAGTAAAAGGACAGGCTCAGAGTGTTTCTCGATTGGTGAGCTGAAAC
TAAAATGTCTGTAGAGGAAAAGTAGAGTCGCTACAGAATGCGACGATGAAGGGACAATGCATCTTCAACGCCACATTTAT
CAAGGATCAGGGGTAGGGGCGCTGGGTAAGGACACTGAGTGCTCTTCCAGGGTCCTGAGTTCGGTTCCCAGCACCACGTG
GCAGCTCACATTTATAAAGGATCTTTGTGAACATCAGTTGATCCCGCCATGGCCA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 85808870..85809406 525
NO GENE  

 
Come back to gene ENSMUSG00000022099


For any suggestions or comments, please send an email to unitrap@crg.es