Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D032B11
Clone ID D032B11
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D032B11
Sequence
AAGTAGCTGTTGGGCAGCTTTCGGACGCTTTAAATTTCTGCGGGGTGGAGGGCTTAGCTTGGGTGCCCGGGTCTGGTTTC
TCACTCGCATGGCTGTGGACGTGAAGTCTCGANNGAAGCGCTATGAGAAACTGGACTTCCTCGGAGAGGGACAGTTTGCG
ACGGTCTATAAGGCCAGGGACAAGAACAGCACCCAAATCGTCGCCATTAAGAAA
Sequence Type mRNA
Unitrap ID UNI5870

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 101500413..101500882 148
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069089 (Cdk7) NM_009874 cyclin-dependent kinase 7 (homolog of Xenopus MO15 cdk-activating kinase) Gene [Source:MGI Symbol;Acc:MGI:102956]


SPLK-Sequence tag 5SD032B11
Sequence
GCTGAANGAGACTGGTGTCGACACTAGTGGGATCTCACAGCCCTTACCCAATTAATAAGAGAAATAAAATCCATCTACCA
ACCTCTGCCTCCTTATGTCTAGGATGAAAAACTAAATAAATTATTCGCTCCTCCTACCCCTCCCTCTCCCACTCAAGGGC
AAGACTCCATTAAAAAAACATAGGAGCTACTGCCTGCCTCTCCCTTAATTTCCCTCCCTCCATTCAACCAGAGAGAGGCA
TCTCTCCTCCCCCTTCTCCAAGCCGGAAAAGCAAAACACCTTCCAAACTCACAGCCAAAGCCCCACCTAACTCCATTGTT
CCTTACCCCATCATCTGTCACCCAACAGCTTTTTAATATTGGAGACTCTTGCAAAAACTAACCCCACCTCCCATTCTACT
CAG
Sequence Type genomic DNA
Unitrap ID UNI5870

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 101494336..101494708 373
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069089 (Cdk7) NM_009874 cyclin-dependent kinase 7 (homolog of Xenopus MO15 cdk-activating kinase) Gene [Source:MGI Symbol;Acc:MGI:102956]


SPLK-Sequence tag 3SD032B11
Sequence
GTATACAGTTAGAGAATTTTCCAGCCCTCGTATAAAGTATAAGGAACAAAATGTCTTTGGGATGCCCATTGCTTTGTAGA
GTTTGTAGTGTTCATTCAGTGCTACTGGCTTTGGGTTTTGTTTTGTTTTTTTTAATCTATCACATGTTGTAGGTTTGCTT
TGTGAAAAATGCAGGATTATCAAC
Sequence Type genomic DNA
Unitrap ID UNI5870

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 101493894..101494077 184
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069089 (Cdk7) NM_009874 cyclin-dependent kinase 7 (homolog of Xenopus MO15 cdk-activating kinase) Gene [Source:MGI Symbol;Acc:MGI:102956]

 
Come back to gene ENSMUSG00000069089


For any suggestions or comments, please send an email to unitrap@crg.es