Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D032C11
Clone ID D032C11
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D032C11
Sequence
CCTGGTTGGTTGCTTTATTTTTTTTCCTCCAAAATTTTACCCCTCCCCCCTCAGCGCGAGGTGCTGACGTCGCAAAAAAA
TTGGATA
Sequence Type mRNA
Unitrap ID UNI10120

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 36054575..36054661 83
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039220 (Ppp1r10) NP_787948 protein phosphatase 1, regulatory subunit 10 Gene [Source:MGI (curated);Acc:Ppp1r10-001]


SPLK-Sequence tag 3SD032C11
Sequence
TTGTGTGTGAGAAAGCAGAACGCCTTTCAATTTGCCAGATTAATAAGCAATCTGTACATAAAGATTGCAGGGTAAGGAGA
TGGGCAGAGAAATATTAGCTGGCTATGTCTTTAAAGTGACTGTTAAATCCTCTCTATTTTACTGAAATTTGCTTGGGATA
TATTGTGTGGTCACAATAGGTGGCAATCTAGGAATATCGATTGCGAGACACTTAAATTTAGGGCTTAAATCTTAGTACCT
AGTACATACGATAACATTTGGGGAGGAATAGAATGTCTTGTGATTGTCTCAGCTTGCATAGGCTATTTACAGGCGAAAGA
GATTACCATTTTAACTTGATACTTTNNTAGCNNGGAGCAGGATACAGCTAAGAGGGTGGAAAGGTTGGGAAATGTGGAAC
TCAGGAGTATAATTTTAAAAGCCATTAGTGCATTTGAATGCTATCTTTCTAGAAGATTGTGTCGTTAAAAGATTTTTTTT
TTCCTCCCTGCTTCA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000039220


For any suggestions or comments, please send an email to unitrap@crg.es