Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D032E09
Clone ID D032E09
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D032E09
Sequence
CCGGGCTTTTGGGAAAGCAGCAGCACCAGATCCAAGATGGCGGCCAGCAGGAGGCTGATGAAG
Sequence Type mRNA
Unitrap ID UNI2763

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 27656140..27656196 57
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000064208 (AC160404.13) Putative uncharacterized protein Fragment [Source:UniProtKB/TrEMBL;Acc:Q3TW19]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 17201528..17201584 57
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038965 (Ube2l3) NM_009456 ubiquitin-conjugating enzyme E2L 3 Gene [Source:MGI (curated);Acc:Ube2l3-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 22069599..22069655 57
 
EST/CDNA Est Name
  AK165620.1 - BC106149.1


SPLK-Sequence tag 5SD032E09
Sequence
GATCTGCGGACATCCTCTAAAGATAACCCGCCAGTGTTTGAGTGCTACCTGGTAGTGCGGCCGACTCTCGCCGGACCGGA
AATAAAAAAGGTCGCAGGAGCTGGCTCTTGAGACCAAATTTGTATTTGGTTGATGGAGTCACTGGAAACAAAAGAAAGCC
ATTTGCTCACTGAAACCTAGAGAGAACATTTGATAAAA
Sequence Type genomic DNA
Unitrap ID UNI13985

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 17200467..17200665 195
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038965 (Ube2l3) NM_009456 ubiquitin-conjugating enzyme E2L 3 Gene [Source:MGI (curated);Acc:Ube2l3-001]


SPLK-Sequence tag 3SD032E09
Sequence
ATTTACTTACAGGAAAGGAATGCTAGGCACTTCGGGGTTCAGGTGCCAAAAGTTGTCGTCCCTTCAACATNNTGGGTTTC
CGGGTAGTAAGATTTCGGGATTGCATGCTATTTTCTNNAAATTTGATGACATGAANNAGTCTGTCTTTTCTCAGGTCCAC
TTCACTATCCTTTTGCATGGATACGCTTCTTGGGCTCCAGAGATCTTTTCTCTAGAGCAAGTATTTAGTCCTTTCCTTCT
GGTTAAAATCCTCTCTGGTTTTGTCCTTAGAAATTCTGACTTTAAACATTTGTAAGTACATTTCTCTCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000038965


For any suggestions or comments, please send an email to unitrap@crg.es