Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13694E7
Clone ID IST13694E7
Vector VICTR74
Project tigm

Sequence tag IST13694E7BBF1
Sequence
AAAGTAAGCTGGGTGGGGGTAACACATGCCCAGCACTCAGGCTGCTGGTTTCCGATTTGAGGACAGCCAGAGCTACACAA
AGAAACCCTGTCTTGAAAAACCAAGAAAAGAAAAGAAAAAAGTGCATGTTACCTGAANATAAACGCCCAAGGCTGTCATG
TANCCTCTGTACACACACCCCAAACAGCAAGAACCTTTCCTTCTGTTTTTGCTTGTTTTTCTTTTGTCTTGAGATGGAGG
CTCGTGTCTGGTCCAAGCTTGCTGTGTAATTAAGGATAACTTGGGACACTCCCCTTGGACCTTCTGAGTGCTGGGATGGC
ANGTGGGACCCACTGTGCCCGTTTATGTGGTGCTGGGAATTGAACCCANGGCTTTCATGCATGACAAGCNAGGGCACTCT
ACCANCTNANCCTCACCCCTGCTCNAACCNAANCTTCTNANTNCATGTCCTTN
Sequence Type genomic DNA
Unitrap ID UNI19344

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 134149483..134149934 424
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030681 (Mvp) NP_542369 major vault protein Gene [Source:MGI (curated);Acc:Mvp-001]


Sequence tag IST13694E7HMF1
Sequence
AAAGTAAGCTGGGTGGGGGTAACACATGCCCAGCACTCAGGCTGCTGGTTTCCGATTTGAGGACAGCCAGAGCTACACAA
AGAAACCCTGTCTTGAAAAACCAAGAAAAGAAAAGAAAAAAGTGCATGTTACCTGAAGATAAACGCCCAAGGCTGTCATG
TANCCTCTGTACACACACCCCAAACAGCAAGAACCTTTCCTTCTGTTTTTGCTTGTTTTTCTTTTGTCTTGAGATGGAGG
CTCGTGTCTGGTCCAAGCTTGCTGTGTAATTAAGGATAACTTGGGACACTCCCCTTGGACCTTCTGAGTGCTGGGATGGC
AGGTGGGACCCACTGTGCCCGTTTATGTGGTGCTGGGAATTGAACCCAGGGCTTTCATGCATGACAAGCAAGGGCACTCT
ACCANCTGANCCTCACCCCTGCTCCNAACCCAANCTTCTGANTCCATGTCCTTNACCNACGTCNCNAGTGTTTNNAACTG
NCNTTN
Sequence Type genomic DNA
Unitrap ID UNI19344

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 134149451..134149934 455
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030681 (Mvp) NP_542369 major vault protein Gene [Source:MGI (curated);Acc:Mvp-001]

 
Come back to gene ENSMUSG00000030681


For any suggestions or comments, please send an email to unitrap@crg.es