Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14241B5
Clone ID IST14241B5
Vector VICTR74
Project tigm

Sequence tag IST14241B5HMF1
Sequence
NGATCAAGGCCCAGTGATANAACTCTTACCTANATTCCACCACTGTGGATGCATTGCTCANGTGCANAATTCCTTCATAG
AATCCACCAGTGAGAGGCTGGGGACATGGCTCAGTGGTANAGTACTTTCCTAGGATTCACCATCAAGAGCTCACTGGTCG
AATTCTTCTCTTGATTCCACCAGTAAGGGGCTAGGCTTGTGACTCAGCAAGAGTTCTTGCCTANAATCCTCTACTGAGAG
TCTGGGGGGTGGGGGGAGGTNNNAN
Sequence Type genomic DNA
Unitrap ID UNI12914

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3365085..3365343 247
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069806 (Cacng7) NM_133189 calcium channel, voltage-dependent, gamma subunit 7 Gene [Source:MGI Symbol;Acc:MGI:1932374]


Sequence tag IST14241B5HMR1
Sequence
NCCCTAACTGGTAAATTCTAGGCAGGAGCTCTACCACTGAGCTATATCCCCAGCCCTCTTTTCGCTTTTTATTTTGAATC
AGGGTCTCANTAACTTACTTGCCCAGACAGGCCTGGAACTTTTGAACCTCCTGTCTCAGCCTCCCAAGTAGCTGTCATGA
CNGGGTTGGGCTTCACTTCTGGGTTTTGAATGACCTCTTGTTCTGGGCCTTGGTTGGGTGCACAGAACCCANAAATGAAT
CCANNNNCTGCCCTCGCCCCACCCAATGCCTGCTATCTGANATCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3364803..3365085 267
NO GENE  

 
Come back to gene ENSMUSG00000069806


For any suggestions or comments, please send an email to unitrap@crg.es