Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P098G08
Clone ID P098G08
Vector rFlpROSAbetageo
Project ggtc

Sequence tag P098G08
Sequence
TTCCGCGGCGGCGGCGGTGGTGGAGACGGCTGAGGAGGATGTGGGCTACGCGCGGGCTGGCGGTAGCGCTGGCCCTGAGC
GTGCTGCCTGACAGCCGNNNGCTGCGGCCAGGAGACTGTGAAG
Sequence Type mRNA
Unitrap ID UNI10898

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 106794145..106794264 114
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032575 (Armet) NM_029103 arginine-rich, mutated in early stage tumors Gene [Source:MGI Symbol;Acc:MGI:1922090]


SPLK-Sequence tag 5SP098G08
Sequence
CCCCAGCAACCTAAGGGTTCTGTGCCCTTCTGAGTTCCCGAGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SP098G08
Sequence
TAATAATTANTTACCATCTCCTCCCTCTTTTTCAGTTTGTATTTCTTATCTGGGACGATTTTACCAGGACCTCAAAGACA
GAGATGTCACATTTTCACCAGCCACTATTGAAGAAGAACTTATAAAGTTTTGCCGTGAAGCAAGAGGCAAAGAGAATCGG
TTGGTAAGTAGCTGGTGACCCACCCAGCCTGTCCCTGGCTCTTGGGCACTGTCCACTTTGTGATGGGACTTGTATATATA
CTAATGTGAGGTTTAAGTGTTTTTATCCTCTATTTATTAAACATTGCTATAAGCTGAATATTGGTAAGACCAGGAGAGAA
AATGACAGGCAACTGCAAGGCAGTGATGCCAGATGCCATGAAGGAAATAAGCTAGGAGAGTTGGTGGGTGGGAGCTGAGA
GAGAAAGTAGTGGGTATCTACCTCTGAGGACAGGGAGTCAGTGAGGTGGAGTGAGCACAACTCAGGCAATGGGAGTGCCC
AAAGGCCAGAAAGAATTTGGTGTGATTGGAACCAGAAGTAGTTGGCTAGGTGCCCCGAGATGGCCAGGCCAAGTCAAGGT
CAAGGACCCTGGCGGACATCAGCCTCTTGTAGCTTTAATTTCCATGGTAGTCTCTCATCGGAACTCTAACTCTGCAGCTG
AGCATATATCAAGTGCCTCGGGACTGGGACAGC
Sequence Type genomic DNA
Unitrap ID UNI10898

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 106792890..106793564 657
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032575 (Armet) NM_029103 arginine-rich, mutated in early stage tumors Gene [Source:MGI Symbol;Acc:MGI:1922090]

 
Come back to gene ENSMUSG00000032575


For any suggestions or comments, please send an email to unitrap@crg.es