Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14619D11
Clone ID IST14619D11
Vector VICTR74
Project tigm

Sequence tag IST14619D11BBF1
Sequence
ACTCCAGGGCCTGGCGCTAGCGGCCCTGGCTTTCAGGCTGCTGACCCAAAAGCCGAAGTAACTGTTGCAGGCAACCGAGC
TGACGGTCTGACCCAACACTATGGTTTTCAGTCACTAACCACTACCCCAGGAGACCTCTCCGCCCACAGAGTCCCTGTCA
CGCATGGATCT
Sequence Type genomic DNA
Unitrap ID UNI31171

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 66360005..66360174 170
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000050503 (Fbxl22) NM_175206 F-box and leucine-rich repeat protein 22 Gene [Source:MGI Symbol;Acc:MGI:1921415]


Sequence tag IST14619D11HMR1
Sequence
ATTTTCTGAGGCANANNNNNNNNANNNNNNGNTGNTNNNNNNGTGANGGCTGACTGTGAGTGAATTTCTGAAGCAGGGGG
CTCACTGTGAGTGATTTTCTGGGGCGGGGGGATGACTGTGAGTGAATGTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 166438127..166438211 83
NO GENE  

 
Come back to gene ENSMUSG00000050503


For any suggestions or comments, please send an email to unitrap@crg.es