Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14686B12
Clone ID IST14686B12
Vector VICTR76
Project tigm

Sequence tag IST14686B12HMF2
Sequence
TTAGGACAGTCAGGGCTATACAGAGAAACCCTGTCTT
Sequence Type genomic DNA
Unitrap ID UNI31172 UNI31173

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 3665862..3665897 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 82552855..82552890 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020698 (Cct6b) NM_009839 chaperonin containing Tcp1, subunit 6b (zeta) Gene [Source:MGI (curated);Acc:Cct6b-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 53167014..53167049 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 104470805..104470840 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 109151648..109151683 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 76070090..76070125 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034098 (Fstl5) NM_178673 follistatin-like 5 Gene [Source:MGI Symbol;Acc:MGI:2442179]


Sequence tag IST14686B12BBF1
Sequence
TTAGGACAGTCAGGGCTATACAGAGAAACCCTGTCTTGAAAAACTAAACTAAATTAAACTAAACTAAACTAAAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000034098


For any suggestions or comments, please send an email to unitrap@crg.es