Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14778C3
Clone ID IST14778C3
Vector VICTR76
Project tigm

Sequence tag IST14778C3HMR1
Sequence
ATAGCTNAGGTTACTCTGTTTTGTCTCTCTACCCTTTAAAACAGCCTTGTAAATAAGCAAACACTCGGTGCCAAGCACCT
TCGGCATTTCGCCAGGCTGGTAAATATTTTAGTAGTGACTTGGTAACAGTTGTGCTCACTCTGATTCCCTCGGAAAGGTT
CTTGGTGATGGGGAAGGTCCGAGGCTCTGCNAAACGATCTGCCGGTTATTTATACTCCACTC
Sequence Type genomic DNA
Unitrap ID UNI20147

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 148246983..148247204 218
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028977 (Casz1) NM_027195 castor homolog 1, zinc finger (Drosophila) Gene [Source:MGI (curated);Acc:Casz1-004]


Sequence tag IST14778C3HMF1
Sequence
CTATCAAATGGAGGGGCCAGGTGGTGCCCACCAGCTGCCAGCTGTCCCAGGAACTGTGGGAGCTAAGAGAACATGATGAA
GATTACCCCCCCAAAACAGGTCAGAAAAGTGAGCAGAACGGCTTTGGAGGGCAGGGAGGACCAACCAGTAGCAGCAAGGG
CTCCTGGGAGGCGAGCGAGAAGTGTTGGACCCTGCAGAGCGGCTACCCACCTCTGCCAAACCAGCAGAACAAACTCCTCC
CGCGCCATGAGTTCCAGAGCTGCCCCTGGACTTCTGCATATTCACCTGAGAGCCACCTGGACACCGCCTACCACAGGCTG
TGGGGAAGGGCCCTGGAGCAACAGACAGGCCAGGAAAGGGGAAGCCTAGAGGAAAGCCAAGGGTGGGGGCTGACTGGGAT
CCTGGGANCGGGGATAGAAAGGGGACATGCGGGGACCTGANGANANAANGCACTCNNATTTTCTCTTCCTCCTCTTTCNT
TGAAGTTTCCTTGTGGTTTGAATTTNATTTTGANTTTCTCNACTTTNGCNNANTNNANTTGAAATANCCTNNNNTTNCNT
TAATGTGTTGTAAATNTGGGGNANTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14778C3BBF1
Sequence
CTATCAAATGGAGGGGCCAGGTGGTGCCCACCAGCTGCCAGCTGTCCCAGGAACTGTGGGAGCTAAGAGAACATGATGAA
GATTACCCCCCCAAAACAGGTCAGAAAAGTGAGCAGAACGGCTTTGGAGGGCAGGGAGGACCAACCAGTAGCAGCAAGGG
CTCCTGGGAGGCGAGCGAGAAGTGTTGGACCCTGCAGAGCGGCTACCCACCTCTGCCAAACCAGCAGAACAAACTCCTCC
CGCGCCATGAGTTCCAGAGCTGCCCCTGGACTTCTGCATATTCACCTGAGAGCCACCTGGACACCGCCTACCACAGGCTG
TGGGGAAGGGCCCTGGANCAACAGACAGGCCAGGAAAGGGGAAGCCTANAGGAAAGCNNAGGGTGGGGGCTGACTGGGAT
CT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 148246586..148246986 393
NO GENE  

 
Come back to gene ENSMUSG00000028977


For any suggestions or comments, please send an email to unitrap@crg.es