Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D037B02
Clone ID D037B02
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D037B02
Sequence
TGACAGCGCCGAGGTGCGCCGAGTGGAGCGGGAAACAAAGGAGCTGAGTAGGGAGGGAGGGAATTGGGCCAGGGAGAACC
CCCGGCTGGCTGCCAGAAGATCCCGACTGGAGGAAGCCCAAGTGTCACTTGAATTCCAACCCAGAAGCCAGCGCCTGAGA
CCGGAGCACCTTGTTTAGCAATAGTGGTTGGAACACTCTCTTGTAAGTTACCGGAGCACTAGTATAGGAGGAGGATCATC
GACTACCCTCCCGCCACTCCACGGCTGCTGGCTCCTAGAAACCCCAGCGTCACCTCTCGCTGGNNCTCGAATTTCAGAAT
GAAAAGCAAGAAGG
Sequence Type mRNA
Unitrap ID UNI10902

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 71200212..71200545 322
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047407 (Tgif1) NM_009372 TGFB-induced factor homeobox 1 Gene [Source:MGI (curated);Acc:Tgif1-003]

 
Come back to gene ENSMUSG00000047407


For any suggestions or comments, please send an email to unitrap@crg.es